-
PurposeUsed for in vivo monitoring of ubiquitin localization.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUbiquitin
-
Alt nameUb
-
Alt nameubiquitin C
-
Alt nameUBC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)245
-
GenBank IDNM_021009
-
Entrez GeneUBC (a.k.a. HMG20)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Ub was a gift from Nico Dantuma (Addgene plasmid # 11928 ; http://n2t.net/addgene:11928 ; RRID:Addgene_11928) -
For your References section:
A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. Dantuma NP, Groothuis TA, Salomons FA, Neefjes J. J Cell Biol. 2006 Apr 10. 173(1):19-26. 10.1083/jcb.200510071 PubMed 16606690