Addgene: pORTMAGE311B Skip to main content
Addgene

pORTMAGE311B
(Plasmid #120418)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120418 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA258
  • Backbone manufacturer
    The Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/
  • Total vector size (bp) 9880
  • Vector type
    Bacterial Expression
  • Selectable markers
    Kanamycin, Kan

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli K-12 MG1655
  • Growth instructions
    Induction of expression of Lambda recombinases and MutL E32K allele at 37°C for 15-30 minutes by the addition of 1mM m-toluic-acid
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MutL E32K
  • Alt name
    dominant, negative MutL allele
  • Species
    Synthetic; Escherichia coli K-12
  • Insert Size (bp)
    1848
  • Mutation
    E32K mutation conferring dominant mutator phenotype
  • Promoter Pm

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site - (unknown if destroyed)
  • 3′ cloning site - (unknown if destroyed)
  • 5′ sequencing primer CTAGGGCGGCGGATTTGTCC
  • 3′ sequencing primer GCGGCAACCGAGCGTTCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Lambda Beta
  • Alt name
    Bet
  • Species
    Synthetic; E. coli Lambda phage
  • Insert Size (bp)
    786
  • Promoter Pm

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CTAGGGCGGCGGATTTGTCC
  • 3′ sequencing primer GCGGCAACCGAGCGTTCTG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    XylS
  • Alt name
    Transcriptional regulator XylS
  • Species
    Pseudomonas sp.
  • Insert Size (bp)
    966

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    based on pSEVA258beta, from Ricaurte, Deirdre E., Esteban Martínez‐García, Ákos Nyerges, Csaba Pál, Víctor de Lorenzo, and Tomás Aparicio. “A Standardized Workflow for Surveying Recombinases Expands Bacterial Genome-Editing Capabilities.” Microbial Biotechnology 11, no. 1 (January 1, 2018): 176–88. https://doi.org/10.1111/1751-7915.12846
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information.

To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html

Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORTMAGE311B was a gift from Csaba Pál (Addgene plasmid # 120418 ; http://n2t.net/addgene:120418 ; RRID:Addgene_120418)
  • For your References section:

    Antibiotic usage promotes the evolution of resistance against gepotidacin, a novel multi-targeting drug. Szili P, Draskovits G, Revesz T, Bogar F, Balogh D, Martinek T, Daruka L, Spohn R, Vasarhelyi BM, Czikkely M, Kintses B, Grezal G, Ferenc G, Pal C, Nyerges A.. bioRxiv (2018) 10.1101/495630