pCIS-rPAM3
(Plasmid
#145803)
-
Purposeexpresses rat PAM3 in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCIS
-
Backbone manufacturerCornelia Gorman
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat PAM3
-
Alt namerPAM3
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2400
-
MutationSee depositor comments below
-
GenBank IDAAC05608.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind3 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer CTTGAGGTGTGGCAGGCTTG
- 3′ sequencing primer TGGTGTTGATCTTACGTCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a Valine 221 deletion in rPAM3 compared to the NCBI reference sequence AAC05608.1. This deletion is not known to affect protein activity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIS-rPAM3 was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145803 ; http://n2t.net/addgene:145803 ; RRID:Addgene_145803) -
For your References section:
Differential trafficking of soluble and integral membrane secretory granule-associated proteins. Milgram SL, Eipper BA, Mains RE. J Cell Biol. 1994 Jan;124(1-2):33-41. doi: 10.1083/jcb.124.1.33. 10.1083/jcb.124.1.33 PubMed 8294504