-
PurposeExpresses ChR2-Venus for neuronal excitation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 5864
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChannelrhodopsin2-Venus
-
Alt nameChR2-Venus
-
Alt nameChannelrhodopsin-2
-
Insert Size (bp)1676
- Promoter CAG
-
Tag
/ Fusion Protein
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer ctcctgggcaacgtgctggttg (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byG Nagel, Max-Planck-Institut fur Biophysik, Frankfurt, Germany.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-ChR2-Venus was a gift from Karel Svoboda (Addgene plasmid # 15753 ; http://n2t.net/addgene:15753 ; RRID:Addgene_15753) -
For your References section:
Channelrhodopsin-2-assisted circuit mapping of long-range callosal projections. Petreanu L, Huber D, Sobczyk A, Svoboda K. Nat Neurosci. 2007 May . 10(5):663-8. 10.1038/nn1891 PubMed 17435752