Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-PTEN-shRNA-3001
(Plasmid #25639)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25639 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN-shRNA-3001
  • gRNA/shRNA sequence
    CCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    42
  • GenBank ID
    NM_000314
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium (TRC), MISSION shRNA
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-PTEN-shRNA-3001 was a gift from Todd Waldman (Addgene plasmid # 25639 ; http://n2t.net/addgene:25639 ; RRID:Addgene_25639)
  • For your References section:

    Activation of p53-dependent growth suppression in human cells by mutations in PTEN or PIK3CA. Kim JS, Lee C, Bonifant CL, Ressom H, Waldman T. Mol Cell Biol. 2007 Jan . 27(2):662-77. 10.1128/MCB.00537-06 PubMed 17060456