Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-CAG-GFP
(Plasmid #28014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28014 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2/1
  • Backbone size w/o insert (bp) 5037
  • Vector type
    AAV ; adeno associate viral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    718

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ageI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

with ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CAG-GFP was a gift from Karel Svoboda (Addgene plasmid # 28014 ; http://n2t.net/addgene:28014 ; RRID:Addgene_28014)
  • For your References section:

    Long-Range Neuronal Circuits Underlying the Interaction between Sensory and Motor Cortex. Mao T, Kusefoglu D, Hooks BM, Huber D, Petreanu L, Svoboda K. Neuron. 2011 Oct 6;72(1):111-23. 10.1016/j.neuron.2011.07.029 PubMed 21982373