-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4700
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTcf/Lef:H2B-GFP
- Promoter hsp68
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AseI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GF PGenotFW: A CAACAAGCGCTCGACCATCAC;
- 3′ sequencing primer GFPGenotRW: AGTCGATGCCCTTCAGCTCGAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To g ene r a t e t h e p T CF /L e f :H 2 B -GFP co n s t ru c t , s i x
copies of the TCF/Lef response elements together with
the hsp68 minimal promoter from the TCF/Lef-LacZ
reporter construct [11] were inserted into the AseI/Nhe1
sites of pCMV::H2B-GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tcf/Lef:H2B-GFP was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 32610 ; http://n2t.net/addgene:32610 ; RRID:Addgene_32610) -
For your References section:
A sensitive and bright single-cell resolution live imaging reporter of Wnt/ss-catenin signaling in the mouse. Ferrer-Vaquer A, Piliszek A, Tian G, Aho RJ, Dufort D, Hadjantonakis AK. BMC Dev Biol. 2010 Dec 21;10:121. 10.1186/1471-213X-10-121 PubMed 21176145