Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP(N3)-PP1beta
(Plasmid #44223)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44223 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5684
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PP1B
  • Alt name
    PPP1CB
  • Alt name
    PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    984
  • GenBank ID
    NM_002709
  • Entrez Gene
    PPP1CB (a.k.a. HEL-S-80p, MP, NSLH2, PP-1B, PP1B, PP1beta, PP1c, PPP1CD, PPP1beta)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site PstI (unknown if destroyed)
  • 5′ sequencing primer gtacatcaatgggcgtggatag
  • 3′ sequencing primer gtggtgcagatgaacttcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there is a silent mutation at bp#842 when compared to GenBank reference sequence NM_002709.2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP(N3)-PP1beta was a gift from Angus Lamond & Laura Trinkle-Mulcahy (Addgene plasmid # 44223 ; http://n2t.net/addgene:44223 ; RRID:Addgene_44223)
  • For your References section:

    Dynamic targeting of protein phosphatase 1 within the nuclei of living mammalian cells. Trinkle-Mulcahy L, Sleeman JE, Lamond AI. J Cell Sci. 2001 Dec;114(Pt 23):4219-28. PubMed 11739654