-
Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based system
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF/myc/cyto
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name5X HRE of VEGF
-
Alt nameVEGFA
-
Alt nameVEGF
-
SpeciesH. sapiens (human)
-
Mutationfive copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter EF-1α promoter
-
Tag
/ Fusion Protein
- d2EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer EF1a-F
- 3′ sequencing primer BGHrev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT
The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5HRE/GFP was a gift from Martin Brown & Thomas Foster (Addgene plasmid # 46926 ; http://n2t.net/addgene:46926 ; RRID:Addgene_46926) -
For your References section:
Green fluorescent protein is a suitable reporter of tumor hypoxia despite an oxygen requirement for chromophore formation. Vordermark D, Shibata T, Brown JM. Neoplasia. 2001 Nov-Dec;3(6):527-34. 10.1038/sj/neo/7900192 PubMed 11774035