-
PurposeFluorescent reporter for calcium signaling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTwitch-2B
-
Alt nameTW2B
-
SpeciesOpsanus tau
-
Insert Size (bp)1671
- Promoter CMV
-
Tags
/ Fusion Proteins
- ECFP (N terminal on insert)
- cpCit174 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ccgcggccGCCACCATGGTGAGCAAG
- 3′ sequencing primer acattgaggattgagaattc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Twitch-2B pcDNA3 was a gift from Oliver Griesbeck (Addgene plasmid # 49531 ; http://n2t.net/addgene:49531 ; RRID:Addgene_49531) -
For your References section:
Optimized ratiometric calcium sensors for functional in vivo imaging of neurons and T lymphocytes. Thestrup T, Litzlbauer J, Bartholomaus I, Mues M, Russo L, Dana H, Kovalchuk Y, Liang Y, Kalamakis G, Laukat Y, Becker S, Witte G, Geiger A, Allen T, Rome LC, Chen TW, Kim DS, Garaschuk O, Griesinger C, Griesbeck O. Nat Methods. 2014 Jan 5. doi: 10.1038/nmeth.2773. 10.1038/nmeth.2773 PubMed 24390440