-
Purpose(Empty Backbone) Single component plant T-DNA plasmid. Contains cis- and trans-acting replicational elements from the bean yellow dwarf virus in an LIR-SIR-Rep/RepA-LIR orientation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size (bp) 10531
-
Modifications to backbonecis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
-
Vector typeplant T-DNA plasmid
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tcccactgacttgaagtacac
- 3′ sequencing primer ggacttgtttagagtttcta (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCis-acting elements were amplified from pLSL. The Rep/RepA coding sequence was amplified from pREP.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Due to the repeat regions in this plasmid, Addgene was unable to obtain very much sequence for quality control purposes. The depositing lab recommends performing a diagnostic digest before using.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSLR was a gift from Daniel Voytas (Addgene plasmid # 51500 ; http://n2t.net/addgene:51500 ; RRID:Addgene_51500) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519