Addgene: pLSLR Skip to main content
Addgene

pLSLR
(Plasmid #51500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51500 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone size (bp) 10531
  • Modifications to backbone
    cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
  • Vector type
    plant T-DNA plasmid
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tcccactgacttgaagtacac
  • 3′ sequencing primer ggacttgtttagagtttcta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cis-acting elements were amplified from pLSL. The Rep/RepA coding sequence was amplified from pREP.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Due to the repeat regions in this plasmid, Addgene was unable to obtain very much sequence for quality control purposes. The depositing lab recommends performing a diagnostic digest before using.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLR was a gift from Daniel Voytas (Addgene plasmid # 51500 ; http://n2t.net/addgene:51500 ; RRID:Addgene_51500)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519