Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Flag-PML IV/pRK5
(Plasmid #59742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 4713
  • Total vector size (bp) 6700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PML isoform IV
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1938
  • GenBank ID
    NM_002675.3
  • Entrez Gene
    PML (a.k.a. MYL, PP8675, RNF71, TRIM19)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TTGCCTTTCTCTCCACAGGTGT
  • 3′ sequencing primer GGACAAACCACACTAGAATGCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-PML IV/pRK5 was a gift from Xiaolu Yang (Addgene plasmid # 59742 ; http://n2t.net/addgene:59742 ; RRID:Addgene_59742)
  • For your References section:

    A Cellular System that Degrades Misfolded Proteins and Protects against Neurodegeneration. Guo L, Giasson BI, Glavis-Bloom A, Brewer MD, Shorter J, Gitler AD, Yang X. Mol Cell. 2014 Jul 3;55(1):15-30. doi: 10.1016/j.molcel.2014.04.030. Epub 2014 May 29. 10.1016/j.molcel.2014.04.030 PubMed 24882209