-
PurposeExpresses the isoform IV of Promyelocytic Leukemia Protein (PML) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 4713
- Total vector size (bp) 6700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePML isoform IV
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1938
-
GenBank IDNM_002675.3
-
Entrez GenePML (a.k.a. MYL, PP8675, RNF71, TRIM19)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TTGCCTTTCTCTCCACAGGTGT
- 3′ sequencing primer GGACAAACCACACTAGAATGCAGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-PML IV/pRK5 was a gift from Xiaolu Yang (Addgene plasmid # 59742 ; http://n2t.net/addgene:59742 ; RRID:Addgene_59742) -
For your References section:
A Cellular System that Degrades Misfolded Proteins and Protects against Neurodegeneration. Guo L, Giasson BI, Glavis-Bloom A, Brewer MD, Shorter J, Gitler AD, Yang X. Mol Cell. 2014 Jul 3;55(1):15-30. doi: 10.1016/j.molcel.2014.04.030. Epub 2014 May 29. 10.1016/j.molcel.2014.04.030 PubMed 24882209