-
PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 7400
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
Alt nameS. pyogenes Cas9 nuclease
-
Alt nameCas9
-
SpeciesSynthetic
-
Insert Size (bp)4200
- Promoter pMecp2
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AATGGGGTCCGCCTCTTTTCC
- 3′ sequencing primer cttagctggcctccacctttctcttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX551 was a gift from Feng Zhang (Addgene plasmid # 60957 ; http://n2t.net/addgene:60957 ; RRID:Addgene_60957) -
For your References section:
In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. 10.1038/nbt.3055 PubMed 25326897