Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-CHRNA7
(Plasmid #62276)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62276 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHRNA7
  • Alt name
    hAlpha7
  • Alt name
    Human Alpha7 neuronal nicotinic acetylcholine receptor gene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1638
  • GenBank ID
    NM_000746.4
  • Entrez Gene
    CHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCTGCAGCTCCGGGACTCAACATG
  • 3′ sequencing primer TGCCCATCTGTGAGTTTTCCACATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CHRNA7 was a gift from Sherry Leonard & Henry Lester (Addgene plasmid # 62276 ; http://n2t.net/addgene:62276 ; RRID:Addgene_62276)
  • For your References section:

    The duplicated alpha7 subunits assemble and form functional nicotinic receptors with the full-length alpha7. Wang Y, Xiao C, Indersmitten T, Freedman R, Leonard S, Lester HA. J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23. 10.1074/jbc.M114.582858 PubMed 25056953