Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pJL1
(Plasmid #69496)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69496 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Backbone size w/o insert (bp) 1763
  • Total vector size (bp) 2486
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Super folder GFP
  • Alt name
    sfGFP
  • Insert Size (bp)
    723
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccacaacggtttccctctag
  • 3′ sequencing primer aactcagcttcctttcgggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1 was a gift from Michael Jewett (Addgene plasmid # 69496 ; http://n2t.net/addgene:69496 ; RRID:Addgene_69496)
  • For your References section:

    Cell-free protein synthesis from genomically recoded bacteria enables multisite incorporation of noncanonical amino acids. Martin RW, Des Soye BJ, Kwon YC, Kay J, Davis RG, Thomas PM, Majewska NI, Chen CX, Marcum RD, Weiss MG, Stoddart AE, Amiram M, Ranji Charna AK, Patel JR, Isaacs FJ, Kelleher NL, Hong SH, Jewett MC. Nat Commun. 2018 Mar 23;9(1):1203. doi: 10.1038/s41467-018-03469-5. 10.1038/s41467-018-03469-5 PubMed 29572528