Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAVS1 T2 CRIPR in pX330
(Plasmid #72833)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72833 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 and gRNA for targeting the AAVS1 locus in human cells
  • gRNA/shRNA sequence
    GGGGCCACTAGGGACAGGAT
  • Species
    H. sapiens (human)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer aggctgttagagagataattgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is based on pX330-U6-Chimeric_BB-CBh-hSpCas9 from Dr. Feng Zhang (Addgene #42230)(Cong et al, Science, 2013). The AAVS1 target sequence is described in Mali et al (Mali et al, Science, 2013).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1 T2 CRIPR in pX330 was a gift from Masato Kanemaki (Addgene plasmid # 72833 ; http://n2t.net/addgene:72833 ; RRID:Addgene_72833)
  • For your References section:

    Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Natsume T, Kiyomitsu T, Saga Y, Kanemaki MT. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24. 10.1016/j.celrep.2016.03.001 PubMed 27052166