Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAVS1-PDi-CRISPRn
(Plasmid #73500)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73500 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAVS1
  • Backbone size w/o insert (bp) 3356
  • Total vector size (bp) 12658
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    SpCas9
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4266
  • Promoter TRE
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • 3xFLAG (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rtTA
  • Species
    Synthetic
  • Insert Size (bp)
    853
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer TTCTGATAGGCAGCCTGCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-PDi-CRISPRn was a gift from Bruce Conklin (Addgene plasmid # 73500 ; http://n2t.net/addgene:73500 ; RRID:Addgene_73500)
  • For your References section:

    CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP, Weissman JS, Qi LS, So PL, Conklin BR. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. 10.1016/j.stem.2016.01.022 PubMed 26971820