-
Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 82416-DNA.cg |
Limited Stock Available, 3 units left 2 µg of cloning grade DNA in Tris buffer |
1 | $105 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 13129
-
Modifications to backboneCloned in GFP to replace Puro resistance
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameEGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)720
- Promoter EFS (P2A)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGTCTAAGGGCGAAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA of choice is cloned into vector using Golden Gate assembly, with BsmBI restriction enzyme (as per resource information on Addgene plasmid #52961 by Feng Zhang). Note: This plasmid does not contain a 2KB stuffer sequence between the BsmBI sites.
sgRNA sequencing primer is as follows: 5'-TACGTGACGTAGAAAGTA
Information for Cloning Grade DNA (Catalog # 82416-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2GFP was a gift from David Feldser (Addgene plasmid # 82416 ; http://n2t.net/addgene:82416 ; RRID:Addgene_82416) -
For your References section:
Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Walter DM, Venancio OS, Buza EL, Tobias JW, Deshpande C, Gudiel AA, Kim-Kiselak C, Cicchini M, Yates TJ, Feldser DM. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. 10.1158/0008-5472.CAN-16-2159 PubMed 28202515