Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMJ114
(Plasmid #85995)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85995 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSICO derivative
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 9158
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sgGFP-NT2
  • Alt name
    EGFP-NT2_cr1
  • gRNA/shRNA sequence
    GFP
  • Insert Size (bp)
    113
  • Promoter modified bovine U6-2

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGCGACTACTGCACTTAT
  • 3′ sequencing primer gtacctagtggaaccggaac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    puro-T2A-BFP
  • gRNA/shRNA sequence
    NA
  • Insert Size (bp)
    1371

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJ114 was a gift from Jonathan Weissman (Addgene plasmid # 85995 ; http://n2t.net/addgene:85995 ; RRID:Addgene_85995)
  • For your References section:

    A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, Villalta JE, Gilbert LA, Horlbeck MA, Hein MY, Pak RA, Gray AN, Gross CA, Dixit A, Parnas O, Regev A, Weissman JS. Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048. 10.1016/j.cell.2016.11.048 PubMed 27984733