Addgene: PB-CAG-GFPd2 Skip to main content
Addgene

PB-CAG-GFPd2
(Plasmid #115665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115665 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-GFP
  • Backbone size w/o insert (bp) 5551
  • Total vector size (bp) 6466
  • Modifications to backbone
    Insertion of piggybac inverted terminal repeats and destabilization domain to eGFP
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFPd2
  • Alt name
    Destabilized eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    843
  • Promoter CAG
  • Tag / Fusion Protein
    • Destabilization (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloned GFPd2 from Addgene plasmid 14760 and PBCAG-GFP backbone from Addgene plasmid 40973
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Co-transfection with super piggybac transposase leads to stable integration in mammalian chromosomal DNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CAG-GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665 ; http://n2t.net/addgene:115665 ; RRID:Addgene_115665)
  • For your References section:

    Reducible branched ester-amine quadpolymers (rBEAQs) co-delivering plasmid DNA and RNA oligonucleotides enable CRISPR/Cas9 genome editing. Rui Y, Wilson D, Sanders K, Green JJ. ACS Appl Mater Interfaces. 2019 Feb 22. doi: 10.1021/acsami.8b20206. 10.1021/acsami.8b20206 PubMed 30794383