ROUGE

Gene/Protein Characteristic Table for mKIAA4200

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220300
Description :	DEP domain containing 6.
Clone Name :	mie24089 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1890 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 645 bp

Genome contig ID gi65543215f_55014440
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCCTGGGCAACATAGTGAAACCCCACATTAATTT
Flanking genome sequence
(240298 - 240347)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGGTTTTACCAATATTAGTCTGAATCTGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..1242
Length: 414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL29271	3.2e-164	99.8	DEP domain cont...	Mus musculus
Q570Y9	1.2e-162	100.0	DEP domain-cont...	Mus musculus
EDM16252	1.7e-159	97.8	rCG59709 [Rattu...	Rattus norvegicus
EAW91997	1.1e-156	96.1	DEP domain cont...	Homo sapiens
XP_539149	1.8e-156	96.3	similar to DEP ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173168	5.6e-20	30.3	mKIAA1415
AK220281	2.2e-06	37.6	mKIAA4040

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000591 49 122 PF00610 Pleckstrin/ G-protein

IPR000591 151 222 PF00610 Pleckstrin/ G-protein

HMMSmart IPR000591 50 124 SM00049 Pleckstrin/ G-protein

IPR000591 151 224 SM00049 Pleckstrin/ G-protein

IPR001478 343 412 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000591 41 124 PS50186 Pleckstrin/ G-protein

IPR000591 151 224 PS50186 Pleckstrin/ G-protein

NULL 240 304 PS50324 NULL

IPR001478 335 412 PS50106 PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000591	49	122	PF00610	Pleckstrin/ G-protein
IPR000591	151	222	PF00610	Pleckstrin/ G-protein
HMMSmart	IPR000591	50	124	SM00049	Pleckstrin/ G-protein
IPR000591	151	224	SM00049	Pleckstrin/ G-protein
IPR001478	343	412	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000591	41	124	PS50186	Pleckstrin/ G-protein
IPR000591	151	224	PS50186	Pleckstrin/ G-protein
NULL	240	304	PS50324	NULL
IPR001478	335	412	PS50106	PDZ/DHR/GLGF

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	645 bp
Genome contig ID	gi65543215f_55014440
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCTGGGCAACATAGTGAAACCCCACATTAATTT
Flanking genome sequence (240298 - 240347)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGGTTTTACCAATATTAGTCTGAATCTGTT

Gene/Protein Characteristic Table for mKIAA4200

Features of the cloned DNA sequence

Features of the protein sequence